Development Planning and Analysis

From the modernization theory up to the present trend about sustainable development and climate change, development planning is a major issue since this dictates the direction in which development will take place. For instance, Earth summit’s Agenda 21 aims to alleviate â€Å"worsening poverty, hunger, ill health and illiteracy, and the continuing deterioration of the ecosystems on which we depend for our well-being. † The corruption or purity of development will then pave the way for the possibility of addressing severe social dilemmas. The manner by which development is directed is necessary for the rise or fall or every country.The importance of development planning is even magnified by the Millennium Development Goals which seek to address social dilemmas that paralyzes countries, especially the third world (. In development planning, several aspects must be put into consideration. For one, the demography of a particular setting should be viewed as a profile that wi ll tell the state of development the place has already attained. Demography includes the socio-economic profile that can tell if people satisfy their most basic needs. Women, on the other hand, are another important factor because of the historically-traced experience in repression.Since 51% of the population is composed of women, they must be seriously put into delicate consideration. They have long experienced struggles, and the status by which they have achieved a degree of equality and freedom from repression indicates development and will then become the starting point of several other development plans. Poverty, on the other hand, is another issue. Poverty or the statuses by which people cannot satisfy their needs should be considered in development planning because only through poverty alleviation will countries attain development.These issues are even intensified by the issue of pollution because this dilemma leads to environmental degradation. Since most third world countri es are in the tropics, they depend largely on the environment. Failure to come up with plans that will conserve and preserve the environment translates to inefficiency of development plans being imposed. These issues are heightened by the current trend known as climate change. Everything now from the social sphere to the political ecology becomes a vicious cycle that has to be addressed by long-term and holistic plans to combat even the worst case scenarios.Water purity and availability, occupational health and safety, child welfare, and public health are also important considerations that have to be solved. If one partition of the mentioned considerations is not solved, or is not prioritized, development planning has not become true to its integrity. As many tag the Non-Government Organizations (NGOs), they are the growing force in the development arena since they carry on the interest of marginalized sectors in the society. The projects that have not been carried out by the govern ment are compensated by the activities performed by the NGOs.The language of everyday politics might suggest that they are part of the dynamism of politics; however, other sectors might label them as the heroes that save lives in the absence of the government arm that supposedly helps the impoverished. More so, the multilaterals are involved in development planning. They swathe every development subject, from granting â€Å"financial aid to technical assistance to pushing for democracy. † The role of government and state institutions in development planning is truly essential because they are constitutionally tasked to provide the needs of the people in their respective territories.The state, which is the primary instrument for development, should always be in the service of the citizenry. Many may question the credibility of these institutions, but their role is truly crucial in the developmental aspect. Development is then measured through the assessment if the state is abl e to provide the needs of the people and if the development considerations are prioritized. The question, furthermore, if the business community is a problem or a solution is subjective because it will only be decided depending on the roles they portray.However, the present trend about Corporate Social Responsibility acts as the charitable arm of the government to reach out to the people who are not as affluent as the business sector. In Asia, CSR is really trending and even the capitalists hang on to this to escape criticism of them being over-profiteering. Development planning is not an easy task. To address this, stakeholder’s analyses are conducted. This will help in identifying sectoral needs and interests that vary within communities.The conclusions that will be derived in the stakeholder’s analyses will be beneficial in formulating objectives for development planning. The five entry points for social impact analysis, based on the lecture at City University of Ho ng Kong, are as follows: Social diversity and gender, Institutions, rules and behaviour, Stakeholders, Participation, and Social risk. The mentioned entry points provide for the framework essential in development planning. The social analysis and project design plus the logframe analysis can also be used. Social analyses may be organic but it will help thoroughly in development planning.Development planning in labor rights, democracy and national development are the future because these are the trends that have to be followed and assessed. If these were achieved, even the third world countries will have their own comparative advantages. REFERENCES Lecture notes in Development Planning and Analysis. (2010). City University of Hong Kong. Lecture notes in Social Equity Issues in Social Forestry. (2010). University of the Philippines Los Banos. Lecture notes in Reimagining Philippine Politics. (2007). University of the Philippines Los Banos.

Philosophy: The Immortality of the Soul and Personal Identity

IntroductionThe Concise Oxford Dictionary defines â€Å"soul† as follows: â€Å"Spiritual or immaterial part of man, held to survive death.† This definition highlights the fact that the concept of life after death by means of a â€Å"soul† remains a matter of religious assertion. No authority can prove it. In contrast, the highest authority, the Bible, says: â€Å"The soul that is sinning—it itself will die.† (Eclessiastes 3:11)â€Å"The dust returns to the earth just as it happened to be and the spirit itself returns to the true God who gave it.† In his Commentary, Wesleyan Methodist theologian Adam Clarke writes concerning this verse: â€Å"Here the wise man makes a most evident distinction between the body and the soul: they are not the same; they are not both matter. The body, which is matter, returns to dust, its original; but the spirit, which is immaterial, returns to God† (123).   Similarly, A Catholic Commentary on Holy Scri pture says: â€Å"The soul goes back to God† (90). Thus, both commentaries imply that the soul and the spirit are the same.Through the birth of philosophical notion on the issue of people having an immortal soul, it could then be assured that through the different theories formed by early philosophers, many people were confused about the truth on the matter. Hence, to be able to clearly understand the issue, further studies were made and were formulated to answer the queries of people regarding a living soul. In the paragraphs to follow, the conversation of Miller and Weirob shall be examined as to how the two philosophers arePhilosophy: The Immortality of the Soul and Personal Identity able to clarify the issues of an identical self that continuously thrives even after a person’s death.The Dialogue and the ClaimIn John Perry’s â€Å"A Dialogue on Personal Identity and Immortality†, there is an indication of a conversation that existed between Miller and Weirob. The latter person signifies the existence of a connection between the continuous events in a person’s life that is identified as a personal identity of an individual. According to Miller, the immortality of the soul is the indication that a person’s identity is rather passed on through the years of life of the individual.In the conversation though, it has been pointed out by Weirob that the continuity of a person’s identity does not necessarily depend upon the life and death transition of a person’s experience. However, Miller continues to point out that the continuity of identity that is referred to as â€Å"stage† [a bunch of mental and physical events that are glued together; a set of events that are casually interacting within a person’s life], occurs in a person’s life just once as he is living. The said casual relations are then ‘glued’ together, hence the identity of the person continues well with the years of his life, from the point of his birth towards the days of his old age. A person’s capability of remembering the earlier days of his life helps him identify himself as the same person as he was during the past years compared to who he is at present. Saying this, Miller came up with four major hypotheses about a person’s ability to remember. The said hypotheses are as follows:Philosophy: The Immortality of the Soul and Personal Identity.            If Something is imaginable, it is possible ·Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   It is possible that there will be someone identical with Gretchen Weirob in Heaven ·Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   If identity is imaginable then it is possible.          Survival is identity with a future personThe fact that there has to be a certain connection between the events and the physical experiences that a person passes through life makes the possibility of a life after death experience, or the idea of an immortal soul a poss ible matter at that. According to Miller, the identity of person could only be tracked down through memory. Hence, once an event is remembered by a person then he gains the old personal identity he once had during his earlier or first life. This identity, according to him is someone that exists in heaven. This could be referred to as a complete depiction of the person that is living on earth at present. Hence, this simply means that the person living in today’s world at the present time has an identical person counterpart in heaven, which enables him to remember his past life completely.Weirob however, further argues that even though there exists an immortal soul as other philosophers claim, the said factor of human life [soul] cannot account for identity unlike how people could do as they live. Hence, reincarnation as a way of branching one person’s identity is not at all possible, or someone undoubtedly identical with the person living at present is possible at all.à ‚  Weirob proves this argument by pointing out the differences between remembering and seeming to remember. According to her, there is a big differencePhilosophy: The Immortality of the Soul and Personal Identity between the two activities of the mind. Whereas remembering pertains to the ability of the person to recall the exact things as it all happened to him during an earlier part of his life. However, seeming to remember is to quite know what happened as it happened but not actually knowing the exact events that occurred. To support this claim, Weirob uses an example:  Ã¢â‚¬Å"if for a moment a person is hypnotized to remember as if he has talked to Miller, then another person actually talks to him, the result when asked may not be that easy to distinguish†Thus, a person could be able to remember something if it actually happened to him, however, at some point, some spirit testing and activities also enables a person to remember something that did not even happen. However , remembering in detail would not be that easy to copy as hypnotism does. Hence, here enters the idea of being able to ‘seemingly remember’ things.By stating the said claims, Weirob was also able to come up with her own hypotheses about the matter: ·Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Examining the content of what a person is thinking or saying cannot establish whether that person is identical with a person existing at an earlier time (14,21) ·Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Really remembering a thought or action is just ‘seeming to remember’ it plus having really thought or done it.Philosophy: The Immortality of the Soul and Personal IdentityClearly, Weirob points out that the argument of Miller is plainly proposing that  the real memory is a combination of apparent memory and identity. However, the circularity of the matter proves otherwise. As clearly discussed by Weirob, survival is possible for a person not through the plain ability of being able to rememb er memories but through continuous existence in life. It may not be through being reincarnated or things as such, but through the ability of the person to make himself be remembered by others even when after he dies through his works while he is still living.ConclusionThrough the proofs and the dialogue discussed in this paper, it could then be claimed that the existence of an immortal or immaterial soul is then raised as a questionable theory created by world philosophers. Historians point out that the teaching that man possesses a separate, immortal soul did not originate with the Bible but with Greek philosophy. The New Catholic Encyclopedia observes that the ancient Hebrews did not think of man as being composed of a material body and an immaterial soul. It states about the Hebrews’ belief: â€Å"When the breath of life entered the first man whom God formed out of the ground, he became a ‘living being’ (134). Death was not regarded as a separation of two dis tinct elements in man, as in Greek philosophy; the breath of life departs and man is left a ‘dead being’. In each case the word ‘being’ would be the Hebrew [ne ´phesh], often translated ‘soul’ but, in fact, virtually equated with the person.† That same encyclopedia notes that Catholic scholars recently â€Å"have maintained that the New Testament does not teach the immortality of the soul in the Hellenistic [Greek]Philosophy: The Immortality of the Soul and Personal Identity sense.† It concludes: â€Å"The ultimate solution to the problem is to be found not so much in philosophical speculation as in the supernatural gift of the Resurrection.† Hence, as Weirob and Miller have argued in their conversation, it could be noted that philosophers of both the later and the present era have failed in concluding that there is an immortal soul that continues to thrive after a person’s death to continue one’s identity. I n this regard, it could then be assumed, that as both experts such as Weirob and Miller have argued, there would still be some philosophers who would continue to prove and disprove the matter concerning the existence of a continuum of self-identity after death. However it would be, it would still help if a person tries to search in his own way to be able to find the truth about this theory.BIBLIOGRAPHYCatholic New American Bible. (1970). P. J. Kenedy & Sons, New York.The Protestant Interpreter’s Bible. (1989). Blackwell Publishing Company.Concise Oxford Dictionary. (1987). Blackwell Publishing Company.Ralph Earle. (1997). Adam Clarke's Commentary. Nelson Reference.John R. Perry. (1978). A Dialogue on Personal Identity and Immortality. Hackett Publishing Company  Ã¢â‚¬Å"Dangerous Road†. (July 20, 1990). Time Magazine. Volume 9 Number 5. New York.

A Study On Structural Formworks In High Rise Building Construction

ABSTRACTIn the most recent couple of years extensive requirement for tall structures has been building up. Specific accentuation has been given to decrease the time duration in finishing of these undertakings. Therefore, formworks have been acquainted in order to diminish time and also work cost of such industries.Structural Form works utilized as a part of the Construction has gigantic favorable circumstances due to the speed of finishing of the building. But as this Auto Climbing System is likewise utilized at great heights these variables could prompt significant dangers. These are for the most part utilized as a part of constructing main wall/ divider which fills in as the foundation of the whole structure of the building.Few of such hazards can consist of workers working on platforms posing a threat of tumbling from tallness, damage from equipment tumbling from stature to the individual working underneath the platform. More preference should be given amid the Jumping/Lifting of such platforms. At the point when the platforms are hoisted from a lower level to a larger , more amount of dangers are presented. The objective for this study is to understand different dangers and risks associated with the utilization of such basic form works in the construction business and give legitimate and suitable methods for control measures.INTRODUCTIONIndia is a fast growing country with its cities growing even faster and expanding to newer limits. Such exceptional growth stories have pulled in people from different parts of India to settle and work in its cities. This has led to growing demand of living space required for city families as well as office spaces for companies and other services .For such development plan, limited city area is one of the key reasons for concern. Specifically the expansion of city spaces through horizontal construction is possible only up to a certain extent and will further lead to shrinking of available area for other projects. Therefore high rise buildings in cities are the need of the hour and an efficient way of land management and utilization.In many developed cities around the world their skylines are as famous as the cities themselves. High rise buildings are not just architectural and infrastructural marvels but become a part of city identity and icon. Tall buildings are a marker of city life as well as a standard of better quality of life. Its main benefit is the ability to accommodate a large amount of people with each vertical ascent and thereby saving up a lot of land. Other benefits include lesser exposure to air and noise pollution but better access to natural light and ventilation while offering a high vantage point view of the city itself.Tall structures offer a refuge from floods but it needs design fortification to protect it from other natural calamities like high intensity wind force and lightning. Therefore safety rules and regulation need to be strictly laid out and followed during construction of high rise buildings. Structural stability and security are key aspects of such building safety as they have to be earthquake and fire resistant .In case of high rise buildings it is their height that determines whether safety compliance needs to be fulfilled or not and as such builders have to overlook and furnish fire and earthquake safety plans and exit routes, rescue spaces, electricity supply, service ducts, elevators among others.The construction of high rise buildings requires advanced technology and machinery to aid in the process. One of such new advancement is the Auto Climbing System which is a hydraulically operated self-climbing formwork system. It is useful because it significantly reduces the completion time of construction projects and safer compared to the traditional method of crane lifted formwork often referred to as jump forms.There is a need to evaluate the saf ety of the platforms installed for a secure working environment as there have been reports of industry accidents occuring when the platform is lifted from one level to another. This technique requires more crane time and is too sluggish, dangerous and inefficient for tall structures where the concrete walls dividers are consistently on the analytical way. Despite the fact that Auto or Self climbing framework is a tremendous advancement in diminishing the time required for completing the project, we cant disregard the small deficiency in these frameworks.The importance of this thesis is to give a secure workplace to the work persons and all the staff performing work on or underneath the platform. Huge importance should be given for the establishment of these platforms. It has been generally seen that ,while lifting or jumping of the platform has been carried out , very less investigation has been done as far as the well being of this specific action is concerned. However, a number of accidents have been accounted for while lifting the platform starting with one level then onto the next.. LITERATURE REVIEWAutomated Climbing System can be generally used for the outer part of the main concrete wall, because of the exterior look of building that is concrete or a tower that supports the cables. One of the main benefits of Automated Climbing system format includes the lack of over wall that acts like an obstruction which in return allows the steel to be put in a proper manner on the ground ; can be carried to places via mats. ACS arrangement is particularly used for the insides of the main wall as well as used for lifting both inside ; outside part of formwork for building.The first step starts with removing the casing, by using carriages, of the previous casting and then by screwing the climbing shoes to the anchor. These climbing shoes are bolted on every platform which is locked automatically. After that the mechanism is swapped which now climbs the unit than the rail, which is generally done at 50cm/min. when the unit reaches the climbing shoe, before disabling the hyd raulics, it is locked using bars and then with the help of carriage, rebar is fixed by positioning the framework which is ready to be finned with concrete, finally completing the construction cycle. While selecting a proper ACS format for a concerned project, factors that need to be decided are: building form, sequence in which construction will take place, the number and time of cycles need to me mentioned properly, work that needs to be reinforced, and specification needed during placement of boom while climbing. Formworks are divided into wide number of types based on different sizes, location where it will be used, equipments needed for construction, operation nature.Major hazards identified in structural formworks†¢ Extreme weather conditions like heavy rain and strong winds can cause problems in hanging type platform. So proper assessment of weather conditions is of utmost importance.†¢ Unauthorized and untrained personnel should not be allowed to operate the platform as improper handling can cause major hazards.†¢ Fall of material from the platform on the ground below can be hazardous to person standing down.†¢ Ladders and scaffolds erected on temporar y basis should be removed otherwise they can fall while lifting is performed. †¢ Strength of concrete should be high enough before fixing the platform.†¢ Length of cord must be long enough for performing lifting of platform otherwise they could get stretched and break causing spillage of hydraulic oil.†¢ Incompetent and untrained members could cause miscommunication while jumping on platform.†¢ Sufficient clearance must be provided between wall and platform so that it doesnt scrape against the wall causing uneven lift.†¢ If protectors are not provided on platform it could cause slipping of profiles and lead to falling of platform.†¢ Proper access of the platform must be maintained to protect worker from getting stuck.Safety norms and procedures to be followed during the operation of the climbing system. a) On site safety for personnelClimbing rescue walls at the edge of the slab and platform with protectors provide effective safety against falling and also provide protection against extreme weather conditions in case of work at height.b) Safety from extreme weather conditions like high wind loadClimbing operations are of two types crane-dependent climbing procedure and self-climbing procedure. 72km/h is the max wind speed for self climbing procedures. According to German standards such structures are designed to withstand high wind loads. For high wind speeds of over 200km/h statistical proof can be provided.c) Manufacturers service for providing safety to the personnelCompetent assembly personnel, engineers and supervisors should be available at all time for providing help beyond initial phase. Regular assembly and training must be conducted. d) Improvement in quality for safetyEN ISO 9001 Quality System is followed for conducting internal procedures of the company. It provides the basis for best quality of the PERI equipment as well as high quality of development standards. Official approval is provided to PERI climbing anchors and quality of its components is maintained.Control measures and recommendations:It is absolutely imperative that the person operating the lifting of the auto climbing Systems of all hazards and risks associated with the working and the functioning of the auto climbing system. Hence we make it mandatory that the person operating has beengivenproper training an all thesafety aspects have been properly explain to him. Only a certifiedoperator from the manufacture should operate the lifting or jumping of the Auto climbing System.Ensure that we observe all the weather conditions while lifting and operating the Auto climbing System. Extreme weather condition such as high wind speed and torrential rain, it is advisablew should not operate it in harsh climate conditions.The next major hazard to look at is if any looseitem is present on the platform being lifted. During lifting, the material could roll onto the ground which could cause serious injuries to the person below. So, all loose materials should be removed from the platform.CONCLUSIONOur main objective is to highlight the various circumstances ; constraints while managing the utilization of the formwork under various conventional conditions. As most of the major undertakings have to be completed under stipulated time period, so, there is no easy or effortless quick fix while using formwork for typical buildings.We should not avoid the hazards associated with the utilization of formwork at work site. In order to just increase the rate of work to decrease the completion period of construction, it will be wrong to simply not notice the safety in construction because it may endanger the lives of each and every people associated with the work.Therefore, it is very important to focus on the various safety features that have been highlighted in this study. The most important question that we all need to ask ourselves is that – should we follow all the safety rules to have a risk free work place in order to complete the project in right time or should we just try to complete the given work by hook or by crook neglecting the rules thereby endangering all our lives as well as others?

Coaching and Mentoring Skills Assignment Example | Topics and Well Written Essays - 250 words

Coaching and Mentoring Skills - Assignment Example That is, instead of following the performance management process from the manager’s perspective alone, other employees and stakeholders within and outside the organization also get the opportunity to be part of the process (Schraeder & Jordan, 2011). This provision really fits my personality because I am a person who is open to ideas and a manager who prefers the democratic leadership style. In other to use the 360 degree appraisal effectively, there are a number of skills that are very important for achieving success. The first of these is mentorship and coaching. Mentorship and coaching are necessary for the 360 degree appraisal as it is the only way by which other stakeholders who make input to the system can make meaningful contributions (Grote, 2000). Secondly, the skill of evaluation is highly relevant in ensuring that while using this appraisal system, the most accurate evaluation outcomes can be rendered to employees. Last but not least, the skill of corrective training is very relevant if the outcome of the appraisal can be used as a basis for shaping employees to become useful contributors to the

The Future of Leadership Essay Example | Topics and Well Written Essays - 1000 words

The Future of Leadership - Essay Example Reexamining the status of leadership over the past two decades, it is surprising to learn that HRP first released an editorial with the term ‘leadership’ in its heading after more than a decade (Storey 2004). The last twenty years have seen a proliferation of interest in the development of leadership in organizations. Several of the most notable trends and subject matters in the arena of leadership development in the recent two decades are classified either (1) the explosion of strategies in leadership development, or (2) the essence of the emotional quality of a leader with and influence on others (Nahavandi 2003).  One evident pattern over the recent two decades has been the escalating use and understanding of the strength of various developmental skills . Classroom-type leadership exercise is currently matched, or reinforced, with very diverse activities. Action learning is a group of exercises in organization development where in major actual organizational issues are addressed (Rost 1993). Three forms of goals are pursued, according to Palus and Horth: (1) providing assessable organizational outcomes; (2) share knowledge particular to a specific setting, and (3) expanding broader leadership abilities and competencies. Successful action training could range from unsupervised, implicit learning at work to facilitated and planned learning programs to transformations of organizations and individuals.As stated by Ohlott (2004 as cited in Hernez-Broome & Hughes 2004), difficult job assignments are very effective type.... As stated by Ohlott (2004 as cited in Hernez-Broome & Hughes 2004), difficult job assignments are very effective type of leadership development and offer numerous of the developmental prospects in current organizations. The extent of organizational participation in establishing job assignments a component of the process of their leadership development ranges from merely informing people about developmental prospects in their present occupation to a methodical scheme of job rotation (Nahavandi 2003). Making use of job assignments for the objectives of development offers advantages that transcend the mere fact of accomplishing the job and could even provide competitive advantages for the organization (Howell & Costley 2001). Meanwhile, two decades ago, our knowledge of organizational leadership was governed by the traditional two-factor model emphasizing relationship and task patterns (Hernez-Broome & Hughes, 2004). That common model can be typified as inherently transactional, as diff erentiated from a qualitatively distinct model usually characterized as transformational (ibid, p. 24). Transactional leadership is typified by equally advantageous transactions between parties to maximize shared gains including the completion of required organizational duties. The ‘exchange-model nature’ (Hernez-Broome & Hughes, 2004, 24) of transactional leadership has a tendency to generate expected and quite brief results. Transformational leadership stirred the entrenched values and self-worth of subordinates, and resulted in greater degrees of for lower effort and dedication and more permanent change (Nahavandi 2003). Transformational leaders offer interesting images of a better future and encourage trust through

Information Systems Master Essay Example | Topics and Well Written Essays - 2000 words

Information Systems Master - Essay Example Across all brands the bank operates some 1800 sites in the UK. The area considered for analysis is the human resource management of HSBC Bank plc. The various procedures and facilities of the human resource management at the HSBC is discussed. Then an analysis is carried out on various subdivisions like Recruitment, Training etc and evaluation is done by framing models. Once the application form has been received, a credit check will be undertaken. This check will include CCJs, bankruptcy and delinquent debts registered (e.g. defaulted on payments to a loan which has not yet been paid in full.) Full details on this are contained within the application form. This is the next stage and is undertaken online. Typically instructions will be received on how to complete this questionnaire within 5 days from your initial submission of the application. The Experienced Commercial Relationship Manager applicants will also receive instructions on how to complete verbal and numeric reasoning tests, which are part of the assessment process for this role. A 30 to 40 minute telephone interview based on key skills for the role applied will be conducted. This is a competency based interview and applicant will need to talk through situations for the displayed particular skills. The final stage conducted by the recruiting manager, ... 1) Initial suitability A series of questions will be asked (such as your eligibility to work in the UK). 2) Online application form Complete the application form as prescribed with appropriate information. 3) Credit Check Once the application form has been received, a credit check will be undertaken. This check will include CCJs, bankruptcy and delinquent debts registered (e.g. defaulted on payments to a loan which has not yet been paid in full.) Full details on this are contained within the application form. 4) Profiling questionnaire This is the next stage and is undertaken online. Typically instructions will be received on how to complete this questionnaire within 5 days from your initial submission of the application. The Experienced Commercial Relationship Manager applicants will also receive instructions on how to complete verbal and numeric reasoning tests, which are part of the assessment process for this role. 5) Telephone interview A 30 to 40 minute telephone interview based on key skills for the role applied will be conducted. This is a competency based interview and applicant will need to talk through situations for the displayed particular skills. The key skills for each Customer Sales roles are: sales, customer service, teamwork, work standards and communication. For the Management roles the key skills are: sales/retail management, relationship building, leadership/team management, customer service, drive, resilience and communication. 6) Face-to-face interview The final stage conducted by the recruiting manager, typically at the location for the role applied for. Again the interview will focus on applicant's skills and experiences and how they match with Bank's requirements.

Grieving and Support of a Dying Patient Case Study

Grieving and Support of a Dying Patient - Case Study Example It was important to conduct an assessment before this decision, so Mary's needs and wishes can be ascertained and incorporated in the care plan. Her assessment included the nature of her condition, type 2 diabetes, social circumstances, experience of healthcare, approach to life, mental health status, psychological wellbeing, and cultural, religious, and spiritual views. Taking Mary's condition into account, she lives in a remote area, where healthcare access is sparse, and the acute specialized care available will be less. Therefore, an open and honest communication with Mary was initiated. She was obviously grieving, and it was my job to identify the triggers for discussion. In this discussion, she was communicated regarding the agreed care plan, and over the time, review of her needs and preferences were made. The needs of care included not only maintenance of her diet and blood sugars, and prevention of other complications without heroic treatment, since she preferred to die at home. The ultimate outcome for dying patients is to achieve good end of life care and a good death.

An Essay Example | Topics and Well Written Essays - 750 words

An - Essay Example The first article is a deposition by one Francois Lapierre, â€Å"a man of color from the small town of Petit Anse† (Lapierre 222) who is a sublieutenant in the Compagnie Beaubert of the National Guard of the town (Lapierre 223). Traveling to Cap Francais on business his boat is stopped and boarded by another boat looking for free black men to arrest that they believe are part of a revolution. He resists and white soldiers, including its captain try to protect him and other coloreds threatening to kill the white French sailors if they dare try to take him. (Lapierre 223). Over time he is transferred to several ships, including the Jupiter where officers protect him from the violent crew who want to â€Å"cut off his head† (Lapierre 224). Lapierre and other coloreds are eventually assured of safety by Cambis and Roussel but are falsely accused as â€Å"agents of the...Commissioners† (Lapierre 227) [a group backing the cause of the slaves], and without trial are su bsequently condemned at one point to death. He eventually finds his way to an American vessel and is transported safely home to Petit Anse with the help of French dignitaries. It is hard to say whether I believe his story or not since the deposition was apparently not corroborated by other witnesses. Although he does not appear political, one might ask does he want to return home for sentimental reasons or to perhaps rejoin his fighting comrades? The second article, The Oge Insurrection, concerns Vincent Oge, a free man of color, overtly political and an official representative of freed blacks to the French government (Verneuil 45) who leads a brief insurrection in 1791 to convince the Assembly to approve political rights to free black men, a move fiercely opposed by white plantation owners. The account of Oge’s insurrection is told by Louis-Francois-ReneVerneuil , white plantation owner. From that perspective one must challenge its recounting as undoubtedly

Final Reflection Essay Example | Topics and Well Written Essays - 750 words

Final Reflection - Essay Example The summary of â€Å"Is Facebook making us Lonely† helped us a lot in understanding audience awareness. The article helped us how to write keeping the dispositions of audience towards the writer. The authors discussed the topic in an excellent way keeping their audience in mind. The summary of the article also informed us about the details involved in responding to audience. The article itself served as a role model for us as to how to communicate with audience using facts and rhetoric together. The subject of the article was very interesting and authors were successful in keeping the interests of the readers at all times. The summary of the article also helped us to learn about summarizing and paraphrasing. It helped us understand how to read and summarize a particular work without ignoring every small detail. I personally learned how to concisely summarize a long article in a few pages. This course has also helped me recognize the importance of rhetorical stance especially through the class discussions. In the class discussions we learnt how to maintain a clear stance throughout the discussion without changing sides. It was more about building a whole case around a central thesis. This helped my writing a lot because previously there was less coherence in my work. I used to discuss many things in a single paper and did not focus too much on a central theme or purpose. Class discussion made me understand how important it is to think about a purpose when writing about a topic. Research paper probably helped me the most as it made my research skills better. I learned how to use search engines and other sources to get the relevant information in a less amount of time. There is loads of information now at our disposal but it is very difficult to extract the right kind of information in a short time. I believe that research paper writing helped me research in a better way. When I was doing the paper I had to analyze other people’s work and

History of philosophy Essay Example for Free

History of philosophy Essay The study of philosophy may deal with every dimension of human life and can raise questions in any field of study or endeavor. Philosophy pursues questions rather than answers. Philosophy is not bound by any particular â€Å"truths† that set limits to the desire to continue asking questions. Philosophy changes historically both in respect to its content and its character. Definitions Etymologically, philosophy is derived from the Greek word philein or philia meaning â€Å"love† or â€Å"friendship† and sophia meaning â€Å"wisdom. † Hence, â€Å"love of wisdom. † The Chinese define philosophy as Zhe-Xue or Che Shueh (originally coined by Dr.Nishi Amane). Zhe means â€Å"wisdom† while Xue means â€Å"study. † Significantly, the Chinese character Zhe bears the emblem of mouth and hand which suggests the inseparability of words and action. This philosophy is the translation of words into action or the application of theory into praxis. Hence, for the Chinese, philosophy singles out a person to live on what he says. For the Hindus, philosophy is Darsana. Darsana means seeing, not only through the eyes but through the whole being of the one that sees. In other words, philosophy for the Hindus means seeing the whole reality through a total advertence and involvement of the looker. Philosophy refers to the field of study of the process which includes standards and guidelines for thought and for logic by which people develop concepts and principles which describe people, things and events, and techniques for using the concept and principles for the purpose of observing, analyzing, understanding, evaluating, organizing, and dealing with themselves and other people, things, and events who/which comprise reality (Kroepel, 2011) Philosophy refers to a human drive in the search of knowledge and wisdom to facilitate the evolution of man. Philosophy studies the fundamental nature of existence, of man, and of man’s relationship to existence. CONCEPT OF PHILOSOPHY In order to live, a man must act; in order to act, he must make choices; in order to make choices, he must define a code of values; in order to define a code of values, he must know what he is and where he is, he must know his own nature (including his means of knowledge) and the nature of the universe in which he acts. All of this things put together, is the very concept of PHILOSOPHY. Origin of Philosophy Western Philosophy began in Miletus ( accdg.to Reginald Ellen). The radix of the claim lies on Thales: the acclaimed first philosopher. Historically, western philosophy began in Greece. The word philosophy is even derived from the Greek language and means a love of wisdom. Ancient western philosophy had three main branches: ethics, logic, and physics. These three branches have now broken into even smaller sub-sections, covering everything from epistemology to aesthetics. Socrates was a large influence on western philosophy, but there was a pre-Socratic era that covered philosophical topics. Eastern philosophy has its roots in religion, specifically the Abrahamic religions (Islam, Judaism Christianism). It is more concerned with asking questions about God and how the world relates to God. Abrahamic religions (also Abrahamism) are the monotheistic faiths of Middle Eastern origin, emphasizing and tracing their common origin to Abraham or recognizing a spiritual tradition identified with him. They are one of the major divisions in comparative religion, along with Indian religions (Dharmic) and East Asian religions (Taoist). Abraham was said to have lived during the Iron Age sometime after 2000 B. C. E. , in the city of Ur in Mesopotamia. The way eastern philosophers created theories on knowledge and religion has led people to practice the philosophies of certain philosophers without adopting all aspects of that branch. For example, some people may consider themselves believers in the Buddhist philosophy, but they never actually go and worship Buddha. The eastern philosophers historically believed that religion was a large part of the study of philosophy. Contemporary practices of eastern philosophy often remove the religious part. Islam impacted much of what we now consider eastern philosophy, meaning that most branches have a religious aspect. The most common branches of eastern philosophy include: Taoism, Buddhism, Hinduism, Maoism, Shinto, Confucius, and Legalism. Both regions can attribute a large amount of current philosophical thought to some form of religion. The eastern world chose to embrace religion as their main pursuit of knowledge, while the western world broke philosophy into a bunch of different branches. Branches of Philosophy Epistemology This refers to the branch of philosophy that is broadly defined as the study of knowledge. It answers the question, â€Å"how do we know? † It encompasses the nature of concepts, the construction of concepts, the validity of the senses, logical reasoning, as well as thoughts, ideas, memories, emotions and all things mental. It is concerned with how our minds are related to reality, and whether these relationships are valid or invalid. Aesthetics refers to the branch of philosophy that is broadly defined as the study of art. It answers the question, â€Å"what life can be like? † In philosophy, aesthetics is important because it delves into the reason why art has always existed to reflect and express the desire and need of mankind through the ages to see the world in a different and clear way. It further evaluates art by using the standards of human life, and if whether it accomplishes the job of satisfying man’s intellectual needs, or whether it tends to hurt or make worse of those needs. Metaphysics Literally means beyond physics, this refers to the branch of philosophy that is broadly defined as the study of existence. It answers the questions, â€Å"What is out there? † or â€Å"What is real? † As the foundation of philosophy, metaphysics is also regarded as the fundamental view of the world. It encompasses everything that exists, as well as the nature of existence itself. It determines whether the world is real, or merely an illusion. Ethics This refers to the branch of philosophy that is broadly defined as the study of action. It answers the question, â€Å"what should I do? † Ethics deals with the proper course of action for man. Specifically, it answers whether or not a human act is good or bad. At a more fundamental level, Ethics can also be defined as the method by which people categorize values and pursue them. Logic It is the branch of philosophy that is broadly defined as the study of reason. It answers the question, â€Å"what is correct reasoning? † Furthermore, logic attempts to distinguish a fact from fallacy. Politics It refers to the branch of philosophy that is broadly defined as the study of force. It answers the question, â€Å"what acts are permissible? † Under its philosophical perspective, politics is ethics applied to a group of people. Brief History of Philosophy. Pre-Socratic Philosophy Characterized by the rejection of the mythological explanation on the nature and phenomena in the universe. The thinkers under this time period were mainly concerned with the search for the â€Å"true essence of things† and made use of systematic and scientific approach in uncovering the realities in the universe. Pre-Socratic Philosophers Thales (c. 624 – 546 B. C. ) Greek philosopher who was regarded as the first philosopher in western tradition. He became known for positing that water is the single element that comprised all things in the universe. He also made famous the aphorism, â€Å"know thy self. † Anaximenes (c. 610 – 546 B. C. ) A student of Thales who postulated that air is the source of all things in the universe. His major contribution, however, was stating that nothing can be created from nothing. Matter, force, and energy are indestructible. These ideas later reappeared in physics in the laws of the conservation of matter and energy. Anaximander He explained the world as originating in conflicts between contraries, such as hot and cold and wet and dry. The cold partly dried up, leaving the Earth and its water. The hot turned some water into mist and air, while the remainder ascended to form fiery rings in the heavens. Holes in the rings are the sun, moon, and stars. CLASSICAL PHILOSOPHY Classical Philosophy was primarily characterized by the rise of the â€Å"Great Greek Triumvirate† – Socrates, Plato Aristotle. Classical Philosophers Socrates (c. 469 – 399 B. C. ) A Greek philosopher who became known as one of the most prominent philosopher in Ethics. Unlike his contemporaries, Socrates was more concerned with how people should behave rather than how the world works. Plato (c. 428 – 348 B. C. ) A student of Socrates who become known for through his dialogues which contained the presentation of his ideologies and theories in a conversational form. Aristotle (c. 384 – 322 B. C. ) He was the student of Plato and became known as the first thinker to create a comprehensive system of philosophy, encompassing Ethics, Aesthetics, Politics, Metaphysics, Logic and Science. MEDIEVAL PHILOSOPHY Medieval Philosophy was the period predominantly composed of philosophers who were concerned with proving the existence of God and with reconciling Christianity/Islam with the classical philosophy of Greece particularly that of Aristotle . This period also saw the establishment of the first universities, which became an important factor in the subsequent development of philosophy. Medieval Philosophers Avicenna (980 – 1037) A Persian philosopher, physician and polymath during the Golden Age of Islam. As a philosopher and a devout Muslim, he tried to reconcile the rational Greek philosophy with Islamic theology. St. Thomas Aquinas (1225 – 1274) An Italian philosopher and theologian who became a great influence on subsequent Christian philosophies, particularly that of the Roman Catholic Church. EARLY MODERN PHILOSOPHY Early Modern Philosophy. The rise of Modern Philosophy can be attributed to certain historical and cultural changes that happened between the Age of Reason during the 17th century and the Age of Enlightenment during the 18th century. Among the changes during the said period were the advancement in science, the growth of religious tolerance and the rise of liberalism (promotion of liberty and equality). Early Modern Philosophers Rene Descartes (1596 1650) A French philosopher, mathematician, scientist and writer of the Age of Reason. He has been called the â€Å"Father of Modern Philosophy†, and much of a subsequent Western philosophy can be seen as a response for his writings. He is responsible for one of the best-known quotations in philosophy: â€Å"Cogito, ergo sum† or â€Å"I think, therefore I am† (Mastin 2008). Baruch Spinoza (1623 1677) a Dutch philosopher who was a contemporary of Descartes. Spinoza became famous for his belief that absolutely everything including human behaviour occurs through the operation of necessity, leaving absolutely no room for free will and spontaneity. Gottfried Wilhelm Leibniz (1646 1716) A German philosopher, mathematician, scientist and polymath who postulated the concept of â€Å"monads† which refers to the ultimate element of the universe from which all things, including human beings and God himself are made of. Immanuel Kant (1724 1804) A German philosopher during the Age of Enlightenment. He is regarded as one of the most famous thinkers in modern philosophy. His contributions in all branches of philosophy are often described as being, â€Å"immeasurable†. Kant’s Copernican Revolution. One of the most popular Kantian theories which states that the â€Å"representation† of an object greatly helps the perceiver to perceive a certain object and not the object per se. To put it more accurately, tangible materials (such as the actual glass) are less important in perceiving the glass. What is important is how we experience the â€Å"glassness† of the glass through experience. Kant believed that the human mind can be compared to a tabula rasa (blank tablet). Examples: It is like a computer with no operating system. A computer with no â€Å"O. S. † should be installed with various programs to function properly. A new born baby should be exposed with positive experiences which may affect his lifestyle and manner on how he/she perceive things. MODERN PHILOSOPHY Modern Philosophy. The modern period of philosophy generally refers to the 19th and 20th centuries. The late 20th Century which is sometimes referred to as the contemporary period, became the venue of major development in philosophy characterized by the rise of new philosophical movements. Modern Philosophers Jeremy Bentham (1748 1832) An English philosopher, political radical and legal and social reformer of the early modern period. He became the founder of the Utilitarianism which refers to the principle that holds that the right action is that which would cause â€Å"the greatest happiness of the greatest number†. John Stuart Mill (1806 1873) An English philosopher and political scientist who was the protege of Bentham and conducted major improvements on the principles of Utilitarianism. Friedrich Wilhelm Nietzsche (pronounced NEE-cha) (1844 – 1900) A 19th Century German philosopher who was known for challenging the foundations of Christianity and traditional morality, famously uttering, â€Å"God is Dead†. EASTERN WESTERN PHILOSOPHIES: AN OVERVIEW Western Philosophy Refers to the philosophical thinking in the Western or Occidental world, particularly in Europe. Historically, it refers to the philosophical thinking of Western civilization, beginning in ancient Greece. Western thought puts more emphasis on individualism, science, math, and politics – hence, rational and materialistic. It can be seen as the triumph of reason and empiricism over faith/religion – a search involving many questions. Eastern Philosophy. Refers broadly to the various philosophies in the Eastern or Oriental world, particularly Asia and some Arab countries. Historically, it is heavily influenced by Hinduism the world’s oldest religion, beginning in India. Eastern thought puts more emphasis on interdependence (of human beings and nature), harmony, unity, and faith – hence, meditative and spiritual. It can be seen as the triumph of faith/religion over science and reason – an answer following realization. KEY CHARACTERISTICS OF EASTERN WESTERN PHILOSOPHIES Western Philosophy. Is rational because most western thought focused on refining epistemology and logic. It emphasized that it is the individual using his/her rational ability to deduce the truth about the things around him/her, and this separates the individual as a subjective mind different from objective reality: Nature, God, the Universe. Eastern Philosophy In the East, philosophers have been more concerned with ordaining society in a harmonious manner, finding humanity’s proper place in society and nature, acting and thinking in a way that would promote unity and order in the universe. It does not have to rely on rationality and often tries to transcend individuality itself to reveal a person’s inherent sameness with the universe/nature. Reason is in fact seen as a stumbling block to truly understand reality. It focuses on how to live and tends to accept the way things are. Eastern thought is focused more on the mind and the spirit/soul, tending to offer a different level of internal experience (meditative) from which to draw conclusions. Thus, it would be hard to separate philosophy and religion.

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.